View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_high_95 (Length: 241)
Name: NF11980_high_95
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_high_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 51294199 - 51294411
Alignment:
| Q |
11 |
actaaaagaagatacctcacataataatataggttagcttagaggtcaagtattcttccaaaaatcatatcttatagtgataatatgggaggcaagaagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294199 |
actaaaagaagatacctcacataataatataggttagcttagaggtcaagtaatcttccaaaaatcatatcttatagtgataatatgggaggcaagaagt |
51294298 |
T |
 |
| Q |
111 |
cctcttccttttgtggtatgttgaagtcttgtttctcaagtggaggaagcagtagggatgattattactattatgatgatgatggcagtagcagaaggat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294299 |
cctcttccttttgtggtatgttgaagtcttgtttctcaagtggaggaagcagtagggatgattattactattatgatgatgatggcagtagcagaaggat |
51294398 |
T |
 |
| Q |
211 |
atttgcaagtgat |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51294399 |
atttgcaagtgat |
51294411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University