View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11980_low_100 (Length: 242)

Name: NF11980_low_100
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11980_low_100
NF11980_low_100
[»] chr4 (1 HSPs)
chr4 (10-242)||(52826822-52827054)


Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 242
Target Start/End: Complemental strand, 52827054 - 52826822
Alignment:
10 gacatcaatgaaaggtctacaaagcttgattaagaagtcaacgccgtcatcttttgtgtacatatccgagaaacttggaaattcactcattgacaaggta 109  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
52827054 gacatcaatgaaaggtctacaaagcttgattaagaagtcaacaccgtcatcttttgtgtacatatctgagaaacttggaaattcactcattgacaaggta 52826955  T
110 cttttggaaaggaaacttatttaatttatatgtatacgttatggaaaataatgctttgatcttgtctcttttttagatggatgaattagcatgttttgtt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52826954 cttttggaaaggaaacttatttaatttatatgtatacgttatggaaaataatgctttgatcttgtctcttttttagatggatgaattagcatgttttgtt 52826855  T
210 cctggaatgctggctttgggatcttctggctac 242  Q
    |||||||||||||||||||||||||||||||||    
52826854 cctggaatgctggctttgggatcttctggctac 52826822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University