View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_103 (Length: 240)
Name: NF11980_low_103
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_103 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 53240022 - 53240244
Alignment:
| Q |
18 |
gaaggaatacattttaagagatgagcatgtaactaaacaatgggatagtttgaattttgtgttgcaacttcgatttatggtaacacacattcaaagaggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53240022 |
gaaggaatacattttaagagatgagcatgtaactaaacaatgggatagtttgaattttgtgttgcaacttcgatttatggtaacacacattcaaagaggg |
53240121 |
T |
 |
| Q |
118 |
aaaatgacatagccctctacttatacattgcacataccatacgaatttgtactcatacaactcaattgggccaaataaattgggcaattaaaagtttacc |
217 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53240122 |
aaaatgacagagtcctctacttatacattgcacatactatacgaatttgtactcatacaactcaattgggccaaataaattgggcaattaaaagtttact |
53240221 |
T |
 |
| Q |
218 |
tgtaattcaacagtttcaacttt |
240 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
53240222 |
tgtaattcaaaagtttcaacttt |
53240244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University