View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_105 (Length: 239)
Name: NF11980_low_105
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_105 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 36437300 - 36437077
Alignment:
| Q |
16 |
gatcaatcattaggagagtcattctctgagcttgaagttcaaagatgcatccaaattgggcttttatgtgtacaagattttgctgttgacagaccatcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36437300 |
gatcaatcattaggagagtcattctctgagcttgaagttcaaagatgcatccaaattgggcttttatgtgtacaagattttgctgttgacagaccatcaa |
36437201 |
T |
|
| Q |
116 |
tgtcagctgttgtttctatgttgggtagtgactcaactcttcccactccaaaacaaccagcattcattttcaagagaagcaattatgagacttcaaatcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36437200 |
tgtcagctgttgtttctatgttgggtagtgactcaactcttcccactccaaaacaaccagcattcattttcaagagaagcaattatgagacttcaaatcc |
36437101 |
T |
|
| Q |
216 |
atcaatcagtgaaggaacttactc |
239 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
36437100 |
atcaaccagtgaaggaacttactc |
36437077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University