View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_115 (Length: 234)
Name: NF11980_low_115
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_115 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 7550021 - 7549806
Alignment:
| Q |
16 |
atagcatatgattatcagtaacagcagcattccccacatagttccaagtcaccttcttaatgaacatatcatgtgtcctagtttaactggatcatgcaaa |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7550021 |
atagcatatgatgatcagtaacagcagcattccccacatagttccaagtcaccttcttaataaacatatcatgtgtcctagtttaactggatcatgcaaa |
7549922 |
T |
 |
| Q |
116 |
tgtaacttctaaagtgaaaaaattatcacgtcatgttaactagtgtcctcataatannnnnnnatatttttgaagaattgagtacagaaattttaataca |
215 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||| |||| | | ||||||||||||||||||| ||||||||||| | |
|
|
| T |
7549921 |
tgtaacttctaaagtgaaaaaattattaggtcatgttaactagtgtccttgcaata-ttttttacacttttgaagaattgagtacacaaattttaatata |
7549823 |
T |
 |
| Q |
216 |
aggtattatatttgtta |
232 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
7549822 |
aggtattatacttgtta |
7549806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University