View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_124 (Length: 204)
Name: NF11980_low_124
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_124 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 51360051 - 51359872
Alignment:
| Q |
1 |
taattattcttgcaggtgttggttgtcacagttaagaattggagtgtgaaagtacctgataattctgaagagttgtatgaaatagagactcataagtcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51360051 |
taattattcttgcaggtgttggttgtcacagttaagaattggagtgtgaaagtacctgataattctgaagagttgtatgaaatagagactcataagtcta |
51359952 |
T |
 |
| Q |
101 |
ctttaaagaacaaactcattcctcacactagccaattcaggttggagtaattttagttatatttctatgatttcctttaagt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
51359951 |
ctttaaagaacaaactcattcctcacactagccaattcaggttggagtaattttagt--tatttctatgattttctttaagt |
51359872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 51350553 - 51350503
Alignment:
| Q |
1 |
taattattcttgcaggtgttggttgtcacagttaagaattggagtgtgaaa |
51 |
Q |
| |
|
||||| |||||| ||||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
51350553 |
taattgttcttgaaggtgctggttgtcacagtcaagaattggagggtgaaa |
51350503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University