View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_64 (Length: 321)
Name: NF11980_low_64
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 956339 - 956550
Alignment:
| Q |
18 |
tgcaatttgtttctatctcttttgatggaatattagtcatcagttactaatattccatgtttctatctcttcataaa-tattgatatgtggaggaannnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
956339 |
tgcaatttgtttctatctcttttgatggaatattattcatcacttactaatattccatgtttctatctcttcataaactcttgatatgtggaggaatttt |
956438 |
T |
 |
| Q |
117 |
nnnagtttatgcctctatatgaatggctttataaacggaacaccacttttaataaaagtttccattacaatatttgaaccttcattgttgttcatgctag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
956439 |
tttagtttatgcctctatatgaatggctttacaaacggaacactacctttaataaaagtttccattgcaatatttgaaccttcattgttgttcatgctag |
956538 |
T |
 |
| Q |
217 |
cttcaggtcatg |
228 |
Q |
| |
|
||| |||||||| |
|
|
| T |
956539 |
ctttaggtcatg |
956550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University