View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_67 (Length: 310)
Name: NF11980_low_67
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 85 - 296
Target Start/End: Complemental strand, 116787 - 116576
Alignment:
| Q |
85 |
tggattggaagtttggacacactatggctatgtttggttccactcttgcgagcagccaaataattgagtctgtgtgtaaaatcgattttgatatgttggg |
184 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
116787 |
tggattggaagtctggacacactatggctatgtttggttccactcttgcgagcagccaaataatcgagtctgtgtgtaaaatcgattttgatatgttggg |
116688 |
T |
 |
| Q |
185 |
ttattttcaaataaatttgattttgtcttcggaatttattttacctttaaattggtatttgtagttttcaagtctaaatgtgattcttgcagtgaaattt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116687 |
ttattttcaaataaatttgattttgtcttcggaatttattttacctttaaattggtatttgtagttttcaagtctaaatgtgattcttgcagtgaaattt |
116588 |
T |
 |
| Q |
285 |
attgttgaacct |
296 |
Q |
| |
|
|||||||||||| |
|
|
| T |
116587 |
attgttgaacct |
116576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University