View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_76 (Length: 282)
Name: NF11980_low_76
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_76 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 17402242 - 17401961
Alignment:
| Q |
1 |
tcaatttgaagaagcccgcaatataagggttgatggtagcgacacacatggaaggtatgcagaaaaatcttgcttcacttcttttacaggagcatagtta |
100 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17402242 |
tcaaattgaagaagcccgcaatataatggttgatggtagcgacacacatggaaggtatgcagaaaaatcttgcttcacttcttttacaggagcatagtta |
17402143 |
T |
|
| Q |
101 |
ttagagacagcgttctaaaattttctggctaacagacggcgttacaaatagtaaattttttcattcctctgcatcagcaagaaaacggagaaatttgatn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17402142 |
ttagagacagcgttctaaaattttctggctaacagacggcgatacaaatagtaaattttttcattcctctgcatcagcaagaaaacggagaaatttgata |
17402043 |
T |
|
| Q |
201 |
nnnnnnnnnnttaaaattaagagactctgctctgggttacgtctcatgatgatctttgttcactggttaaaaattattttac |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17402042 |
aaaaaaaaaattaaaattaagagactctgctctgggttacgtctcatgatgatctttgttcactggttaaaaattattttac |
17401961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University