View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_83 (Length: 265)
Name: NF11980_low_83
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 46085745 - 46085996
Alignment:
| Q |
1 |
gcacgttcagaaccagctaggtccactaaatgaaatttggcacttaagataccatcgcccttcttttgctccatagtgattgtgaatatagcatgtgagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46085745 |
gcacgttcagaaccagctaggtccactaaatgaaatttggcacataagatatcatcgcccttcttttgctccatagtgattgtgaatatagcatgtgagc |
46085844 |
T |
|
| Q |
101 |
ggctagttaaaacatgtaaaccaaacagataacatactataaattactattctgtcaatgtgtttcagtaagtcagtat-nnnnnnntatagcaacaaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46085845 |
ggctagttaaaacatgtaaaccaaacagataacatactataaattactattctgtcaatgtgtttcagtaagtcagtataaaaaaaatatagcaacaaat |
46085944 |
T |
|
| Q |
200 |
tcagaaattcgggatttatttgtataacattttaccttgattgactattcat |
251 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46085945 |
tcggaaagtcgggatttatttgtataacattttaccttgattgactattcat |
46085996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 98
Target Start/End: Complemental strand, 27956550 - 27956456
Alignment:
| Q |
4 |
cgttcagaaccagctaggtccactaaatgaaatttggcacttaagataccatcgcccttcttttgctccatagtgattgtgaatatagcatgtga |
98 |
Q |
| |
|
|||||||||||||| || || |||||||| | || |||| ||||| | ||||||| |||||||||||||| ||||| |||||||| |||||||| |
|
|
| T |
27956550 |
cgttcagaaccagcaagatcaactaaatgtagcttcgcacataagacatcatcgccgttcttttgctccattgtgatggtgaatattgcatgtga |
27956456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University