View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11980_low_86 (Length: 253)

Name: NF11980_low_86
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11980_low_86
NF11980_low_86
[»] chr4 (1 HSPs)
chr4 (1-240)||(53240250-53240485)


Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 53240250 - 53240485
Alignment:
1 ttcaacaacaaaaagtactgctccccggagagtaatgtggtttatagtaattggatttaacacgttgagagcaacacctatatatgctaaagtttcattt 100  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||    
53240250 ttcaacaacaaaaagtactgatccccggagagtaatgtggtttatagtaattggatttaacacgttgagagcaacacctat----gctaaagtttcattt 53240345  T
101 tcgaatggattgagattgactacggtcatgcagtatattcacggctatcgttggatggcaattgaagttcatattttaacttagtattttgtattttaaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
53240346 tcgaatggattgagattgactacggtcatgcagtatattcacggctgtcgttggatggcagttgaagttcatattttaacttagtattttgtattttaaa 53240445  T
201 actgtctgatttcaataacgaccacgatggagccacccct 240  Q
    ||||||||||||||||||||||||||||||| ||||||||    
53240446 actgtctgatttcaataacgaccacgatggaaccacccct 53240485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University