View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_86 (Length: 253)
Name: NF11980_low_86
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_86 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 53240250 - 53240485
Alignment:
| Q |
1 |
ttcaacaacaaaaagtactgctccccggagagtaatgtggtttatagtaattggatttaacacgttgagagcaacacctatatatgctaaagtttcattt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53240250 |
ttcaacaacaaaaagtactgatccccggagagtaatgtggtttatagtaattggatttaacacgttgagagcaacacctat----gctaaagtttcattt |
53240345 |
T |
|
| Q |
101 |
tcgaatggattgagattgactacggtcatgcagtatattcacggctatcgttggatggcaattgaagttcatattttaacttagtattttgtattttaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53240346 |
tcgaatggattgagattgactacggtcatgcagtatattcacggctgtcgttggatggcagttgaagttcatattttaacttagtattttgtattttaaa |
53240445 |
T |
|
| Q |
201 |
actgtctgatttcaataacgaccacgatggagccacccct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53240446 |
actgtctgatttcaataacgaccacgatggaaccacccct |
53240485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University