View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_low_99 (Length: 244)
Name: NF11980_low_99
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_low_99 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 21 - 233
Target Start/End: Complemental strand, 24425922 - 24425706
Alignment:
| Q |
21 |
gcatcatcgcattttacttttattaagtttaatgcatcatgaagttctttaaacgattaaaaatatgtgactgatactactactttgtctagctctcaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
24425922 |
gcatcatcgcattttacttttattaagtttaatgcatcatgaggttctttaaacgactaaaaatatgtgactgatgctactgctttgtctagctctcaag |
24425823 |
T |
|
| Q |
121 |
cgtgcctttacgctgcttcaggcgaaaacaactctgggat----tactgcctagtcagcacctagacacatgtttgatgcgcttagggcgcaaacgactc |
216 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24425822 |
cgtgcctttacaccgcttcaggcgaaaacaactctgggattacttactgcctagtcagcacctagacacatgtttgatgcgcttagggcgcaaacgactc |
24425723 |
T |
|
| Q |
217 |
tgggtttactgaccttt |
233 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
24425722 |
tgggtctactgaccttt |
24425706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University