View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11981_low_6 (Length: 279)
Name: NF11981_low_6
Description: NF11981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11981_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 19 - 159
Target Start/End: Complemental strand, 10818141 - 10818001
Alignment:
| Q |
19 |
attattgtcatgttgcatatctgatctactaggcattcaatctgcatcacaagagacattaataacacattttacgatatcacattgtgggaaaattaag |
118 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10818141 |
attattgtcacgttgcatatgtgatctactaggcattcaatctgcatcacaagagacattaataacacattttacgatatcacattgtgggaaaattaag |
10818042 |
T |
|
| Q |
119 |
acacataccatatatatagggaccaagggagtatataatac |
159 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
10818041 |
acacataccatatatacagggactgagggagtatataatac |
10818001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University