View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_high_9 (Length: 345)

Name: NF11982A_high_9
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_high_9
NF11982A_high_9
[»] chr3 (1 HSPs)
chr3 (11-345)||(48153945-48154285)
[»] chr1 (1 HSPs)
chr1 (107-254)||(4109283-4109427)


Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 11 - 345
Target Start/End: Original strand, 48153945 - 48154285
Alignment:
11 atgaagagcaacaagggactccaagccaccgatgcagataccgccgatgaaagcagccggagtgagagagtgatcggaggtggtggggacggcggggatc 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
48153945 atgaagagcaacaagggactccaagccaccgatgcagataccgccgatgaaagcagcgggagtgagagagtgatcggaggtggtggggacggcggggatc 48154044  T
111 tcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaaga 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48154045 tcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaaga 48154144  T
211 tgatgacagggtgttctgatatgaggcggttgattcgagtttctatggattcgtctatgtccatggatagagaagatgaagagggt------gagttgga 304  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||      ||||||||    
48154145 tgatgacagggtgttctgatatgaggcggttgattcgagtttctgtggattcgtctatgtccatggatagagaagatgaagagggtgagttggagttgga 48154244  T
305 catgatggtagaagcagtgaggttgaggacggttttgcagc 345  Q
    |||||||||||||||||||||||||||||||||||||||||    
48154245 catgatggtagaagcagtgaggttgaggacggttttgcagc 48154285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 107 - 254
Target Start/End: Complemental strand, 4109427 - 4109283
Alignment:
107 gatctcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtg 206  Q
    |||||||||||| || |||| ||| |||||||||| ||| || |||||| |||| || ||| |||||||||| ||||||||||   | ||||| || |||    
4109427 gatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagc---aagaggaacgtgtg 4109331  T
207 aagatgatgacagggtgttctgatatgaggcggttgattcgagtttct 254  Q
    |||||||| || || |||||||||||||| |||| ||| || ||||||    
4109330 aagatgataactggatgttctgatatgagacggtggatgcgtgtttct 4109283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University