View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_high_9 (Length: 345)
Name: NF11982A_high_9
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_high_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 11 - 345
Target Start/End: Original strand, 48153945 - 48154285
Alignment:
| Q |
11 |
atgaagagcaacaagggactccaagccaccgatgcagataccgccgatgaaagcagccggagtgagagagtgatcggaggtggtggggacggcggggatc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153945 |
atgaagagcaacaagggactccaagccaccgatgcagataccgccgatgaaagcagcgggagtgagagagtgatcggaggtggtggggacggcggggatc |
48154044 |
T |
|
| Q |
111 |
tcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154045 |
tcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtgaaga |
48154144 |
T |
|
| Q |
211 |
tgatgacagggtgttctgatatgaggcggttgattcgagtttctatggattcgtctatgtccatggatagagaagatgaagagggt------gagttgga |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48154145 |
tgatgacagggtgttctgatatgaggcggttgattcgagtttctgtggattcgtctatgtccatggatagagaagatgaagagggtgagttggagttgga |
48154244 |
T |
|
| Q |
305 |
catgatggtagaagcagtgaggttgaggacggttttgcagc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154245 |
catgatggtagaagcagtgaggttgaggacggttttgcagc |
48154285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 107 - 254
Target Start/End: Complemental strand, 4109427 - 4109283
Alignment:
| Q |
107 |
gatctcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtg |
206 |
Q |
| |
|
|||||||||||| || |||| ||| |||||||||| ||| || |||||| |||| || ||| |||||||||| |||||||||| | ||||| || ||| |
|
|
| T |
4109427 |
gatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagc---aagaggaacgtgtg |
4109331 |
T |
|
| Q |
207 |
aagatgatgacagggtgttctgatatgaggcggttgattcgagtttct |
254 |
Q |
| |
|
|||||||| || || |||||||||||||| |||| ||| || |||||| |
|
|
| T |
4109330 |
aagatgataactggatgttctgatatgagacggtggatgcgtgtttct |
4109283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University