View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_133 (Length: 323)
Name: NF11982A_low_133
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_133 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 2 - 181
Target Start/End: Complemental strand, 52035811 - 52035632
Alignment:
| Q |
2 |
cacagataataagttctctcccgacaatgtatatcatagctcatccggaaagttgagtagcgttaaaaatgacatgagatgcttttgatcacaatattga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035811 |
cacagataataagttctctcccgacaatgtatatcatcgctcatacggcaagttgagtcgagttaaaaatgacatgagatgcttttgatcacaatattga |
52035712 |
T |
|
| Q |
102 |
caaaacgatgcaatgagtgtgtattaaattttagctactttatttatttcattctctaaaaaatgacacttttttaaaaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52035711 |
caaaacgatgcaatgagtgtgtattaaattttagctactttatttatttcattctctaaaaaatgacacttttgtaaaaa |
52035632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 211 - 262
Target Start/End: Complemental strand, 52035641 - 52035590
Alignment:
| Q |
211 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035641 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
52035590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 288 - 323
Target Start/End: Complemental strand, 52035589 - 52035554
Alignment:
| Q |
288 |
aatgaaccactttattctctctgaccaatttcaaca |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52035589 |
aatgaaccactttattgtctctgaccaatttcaaca |
52035554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University