View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_149 (Length: 313)
Name: NF11982A_low_149
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_149 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] scaffold0245 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 10 - 313
Target Start/End: Complemental strand, 1313981 - 1313678
Alignment:
| Q |
10 |
attatactgttcagatatttaacaattgaatgcagaaaaacacacgtttaattttattattccccaaatttgagtggaagaaaaaagctaggtattcgat |
109 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1313981 |
attatactgttcggatatttaacgattgaatgcagaaaaacacacgtttaattttattattccccaaatttgagtggaagaaaaaagctaggtattcgat |
1313882 |
T |
|
| Q |
110 |
ggaatgggatggggtttgttccatcatatcctattttaaagaattcaactattttatagtttttacgattccatttcatcccgtttgtcaatctaaacac |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1313881 |
ggaatgggatggggttcgttccatcatatcctattttaaagaattcaactatggtatagtttttacgattccatttcatcctgtttgtcaatctaaacac |
1313782 |
T |
|
| Q |
210 |
agccttggtatagtgcttgcaattttttgggcataaaccttctagttcctagggaaaaggagctattgtaatctggttcacactttgaaacattgctata |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1313781 |
agccttggtatagtgcttgcaattttttgggcatagaccttctagttcccagggaaaaggagctattgtaatctggttcgcactttgaaacattgctata |
1313682 |
T |
|
| Q |
310 |
gtgc |
313 |
Q |
| |
|
|||| |
|
|
| T |
1313681 |
gtgc |
1313678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 223 - 313
Target Start/End: Complemental strand, 1294757 - 1294667
Alignment:
| Q |
223 |
tgcttgcaattttttgggcataaaccttctagttcctagggaaaaggagctattgtaatctggttcacactttgaaacattgctatagtgc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
1294757 |
tgcttgcaattttttgggcataaaccttctagttcctagggaaaaggagctattgtaatgtggttcgcactttgaaacattgctatagtgc |
1294667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0245 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: scaffold0245
Description:
Target: scaffold0245; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 223 - 313
Target Start/End: Complemental strand, 22667 - 22577
Alignment:
| Q |
223 |
tgcttgcaattttttgggcataaaccttctagttcctagggaaaaggagctattgtaatctggttcacactttgaaacattgctatagtgc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
22667 |
tgcttgcaattttttgggcataaaccttctagttcctagggaaaaggagctattgtaatgtggttcgcactttgaaacattgctatagtgc |
22577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University