View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_152 (Length: 311)
Name: NF11982A_low_152
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_152 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 3 - 299
Target Start/End: Complemental strand, 53309210 - 53308914
Alignment:
| Q |
3 |
atcaagatgatgatcaccggcgtcgcagtcatccgtgcaatcgacaaacatctggcggagagccttggccagactttggtagctaccgtggttgtgaagg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53309210 |
atcaagatgatgatcaccggcgtcgcagtcatccgtgcaatcgacaaacatctggcggagagccttggccagactttggtagctaccgtggttgtgaagg |
53309111 |
T |
 |
| Q |
103 |
ctgatgcgttggcagatcgaacggccctccaacacaactgtcacagcaggaactacactactagagacaagatcatcatccagctcaagcccatgtgaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53309110 |
ctgatgcgttggcagatcgaacggccctccaacacaactgtcacagcaggaactacactactagagacaagatcatcatccagctcaagcccatgtgaga |
53309011 |
T |
 |
| Q |
203 |
gtgtttgaagtttgttgtacttggnnnnnnnattattactggcataaaaattagccaaagatgaagaactagttgaagatgatgcacctatgatatt |
299 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53309010 |
gtgtttgaagtttgttgtacttggtttttttattattactggcatagaaattagccaaagatgaagaactagttgaagatgatgcacctatgatatt |
53308914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University