View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_164 (Length: 299)
Name: NF11982A_low_164
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_164 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 42984254 - 42984080
Alignment:
| Q |
1 |
tgtaagggaaattaaatattctgagtaagagtctcatcacatattattttgttattttacatgttctttggaaccaccaacttctaagatctaggagttg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42984254 |
tgtaaaggaaattaaatattctgagtaagagtctcatcacatattattttgttattttacatgttcttcagaaccaccaacttctaagatctaggagttg |
42984155 |
T |
 |
| Q |
101 |
gacgtggagctatggcgaattggcgatgatctgctgccgggcatacaccatcaaatgataatcaaccaaaagcat |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984154 |
gacgtggagctatggcgaattggcgatgatctgctgccgggcatacaccatcaaatgataatcaaccaaaagcat |
42984080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 206 - 283
Target Start/End: Complemental strand, 42984080 - 42984003
Alignment:
| Q |
206 |
tcgccatgactccacattacaaagagaatcttgcataactttattgtcaagacgagaatcgctcatgccctatgatgt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984080 |
tcgccatgactccacattacaaagagaatcttgcgtaactttattgtcaagacgagaatcgctcatgccctatgatgt |
42984003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University