View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_165 (Length: 298)
Name: NF11982A_low_165
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_165 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 5950632 - 5950916
Alignment:
| Q |
1 |
acatcattgaaataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccatggtgccagcgatatccatttgatatgtcatcagctctatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5950632 |
acatcattgaaataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccagggtgccagcgatatccatttgatatgtcatcaactctatt |
5950731 |
T |
|
| Q |
101 |
gactgcacccgacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtctggataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5950732 |
gactgcacccgacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtcttgataa |
5950831 |
T |
|
| Q |
201 |
ctgttcgtcctatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaatttgtgatgtcca |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950832 |
ctgttcgtcctatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaatttgtgatgtcca |
5950916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University