View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_167 (Length: 297)
Name: NF11982A_low_167
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_167 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 5 - 288
Target Start/End: Original strand, 28550887 - 28551170
Alignment:
| Q |
5 |
cacatgcaccgtcccaacaaaaaggaaagtgaagtattattgatgtttaaaaatcacaaggttcatgccatattaaacacatttcaataaaactgaatta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550887 |
cacatgcaccgtcccaacaaaaaggaaagtgaagtattattgatgtttaaaaatcacaaggttcatgccatattaaacacatttcaataaaactgaatta |
28550986 |
T |
 |
| Q |
105 |
atgtgctagagactctatctcatcttcacgccaattgcgaatttcctctaagatcccagatggttgtcttgttggatcgttcgtagactcattcttgcac |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550987 |
atgtgctagagaatctatctcatcttcacgccaattgcgaatttcctctaagatcccagatggttgtcttgttggatcgttcgtagactcattcttgcac |
28551086 |
T |
 |
| Q |
205 |
ataagacatgatctcttttcacaggtgataatcttacacgagatattcatacggttcaatagattacgatgactcgagtataat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551087 |
ataagacatgatctcttttcacaggtgataatcttacacgagatattcatacggttcaatagattacgatgactcgagtataat |
28551170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University