View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_195 (Length: 283)
Name: NF11982A_low_195
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_195 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 12 - 281
Target Start/End: Complemental strand, 43547706 - 43547437
Alignment:
| Q |
12 |
atggacatcatcttcgaggcttgaaggaaaatcataattgaccacacattttatgtccttcacatctgcaagaaacaagtaaaacatcataaggaattgt |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43547706 |
atggacataatcttcgaggcttgaaggaaaatcataattgaccacacattttatgtccttcacatctgcaagaaacaagtaaaacatcataaggaattgt |
43547607 |
T |
|
| Q |
112 |
gtgcaaggtttgaggaggaactgcaaacatccttatccctgccccgcaagattctagagatcaaactcaagtcaacacattcatctcatcaatgtgccca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43547606 |
gtgcaaggtttgaggaggaactgcaaacatccttatccctgccccgtaagattctagagatcaaactcaagtcaacacattcatctcatcaatgtgccca |
43547507 |
T |
|
| Q |
212 |
cctgaacctttaagggataaggagaagcttcaccatcactgtcatctaccgtatccaattatcaacaaag |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43547506 |
cctgaacctttaagggataaggagaagcttcaccatcactgtcatctaccgtatccaattatcaacaaag |
43547437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University