View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_201 (Length: 278)
Name: NF11982A_low_201
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_201 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 5 - 102
Target Start/End: Original strand, 27344428 - 27344525
Alignment:
| Q |
5 |
caatatcttatcttatacattaaatagaaattcgaaatcggtggctaaatttggcgcatctctctatgttatcaaagtttttaatctggaatgtaacc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27344428 |
caatatcttatcttatacattaaatagaaattcgaaatcggtggctaaatttggcgcatctctctatgttatcaaagtttttaatctggaatgtaacc |
27344525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 200 - 266
Target Start/End: Original strand, 27346020 - 27346086
Alignment:
| Q |
200 |
ttattggccaagttggatggcacttcttggaagttattaccacacttaatttcaacattttgagaat |
266 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27346020 |
ttattggccaagttggatggcagttcttggaagttattaccacacttaatttcaacattttgagaat |
27346086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University