View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_229 (Length: 270)
Name: NF11982A_low_229
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_229 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 5726343 - 5726603
Alignment:
| Q |
20 |
taaactaattatttagtttggagttccaatttaaacctgtgcatatgaaaaatatatacccgaatatgtcaatatcataaaatgatatcaattaactcaa |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726343 |
taaactaattatttagtttggagtttcaatttaaacctgtgcatatgaaaaatatatacccgaatatgtcaatatcataaaatgatatcaattaactcaa |
5726442 |
T |
|
| Q |
120 |
aaggaatctctacgag--------------acattatttgtttgctaaggaaaaactaagaagttaagggtgcaaaaattaactctaaattttatgcttc |
205 |
Q |
| |
|
||||||||||| | | |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5726443 |
aaggaatctctgcaattgctcgtagatgttacattatttgtt-gctaaggaaaaactaagaagttaaggttgcaaaaattaactctaaattttatgcttc |
5726541 |
T |
|
| Q |
206 |
attatgtcggcatatgttaatatcttaattaaattaaagaaatgctttttccagtctactat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5726542 |
attatgtcggcatatgttaatatcttaattaaattaaagaaatgcttttttcagtctactat |
5726603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University