View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_232 (Length: 270)
Name: NF11982A_low_232
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_232 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 16023345 - 16023076
Alignment:
| Q |
1 |
tggtgctattccacaatcacaagccagtctcggtatgaaccaaggccttgacttggtccatacgctgctggcttgtgccgaggctgttggttgcagagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
16023345 |
tggtgctattccacaatcacaagccagtctcggtatgaaccaaggtcttgacttggtccatacgctattggcttgtgccgaggccgttggttgtagagac |
16023246 |
T |
|
| Q |
101 |
aacaatcaggcaaatttattacttggtaaaattttggctttgtcgagttcttcaggagattcattacaaagagtctcctactgttttgccacggcattga |
200 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
16023245 |
aacaatcaggcggatttgttacttggtaaaattttggctttgtcgagttcttcaggagattcattacaaagagtctccttctgttttgcgacggcattga |
16023146 |
T |
|
| Q |
201 |
agtgtaggttatcactttatccacataatgtattttcaaatagtacactcacaacaagtacttctaatga |
270 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16023145 |
agtgtaggttatcactttatccacaaaatgtattttcaaatagtacactcacaacaagtacttctaatga |
16023076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University