View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_235 (Length: 269)
Name: NF11982A_low_235
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_235 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 6 - 263
Target Start/End: Complemental strand, 52763617 - 52763360
Alignment:
| Q |
6 |
atctagttgtcatcgtcaatggtcttcaatatcaacatgcaaagtaacagcctccaccgccacttttatgccttcatannnnnnnnnnnnnnnnnnnnnn |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763617 |
atctagttgtcatcgtcaatggtcttcaatatcaacatgcaaagtaacagcctccaccgccacttttatgccttcataaccccacccccacccccaccca |
52763518 |
T |
 |
| Q |
106 |
nnntaaagaaaacatctccgccgccaaaatccaacgattttcagccaactcaaacaactgcttaaacctatctctaagaggaatactaactaataaagga |
205 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52763517 |
ccctaaataaaacatctccgccgctaaaatccaacgattttcagccaattcaaacaactgcttaaacctatctctaagaggaatactacctaataaagga |
52763418 |
T |
 |
| Q |
206 |
tttgttcatacaaatgttttgagtccattaccaactacccttttttaatattattcga |
263 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
52763417 |
tttgttcatacagatgatttgagtccattaccaactacccttttttaattttcttcga |
52763360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University