View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_237 (Length: 269)
Name: NF11982A_low_237
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_237 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 257
Target Start/End: Complemental strand, 9459217 - 9458970
Alignment:
| Q |
7 |
cctaaatctcttatctttttgggaagttgtttttgacacccactgttttgctattacacnnnnnnnnnctttctcctttttgaaataatttgtcaagaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
9459217 |
cctaaatctcttatctttttgggaagttgtttttgacacccactgttttgctattacacttttttt---tttctcttttttgaaataatttgtcaagaag |
9459121 |
T |
|
| Q |
107 |
attacgtttgagtgttatttaaccaaaaattgacgttttcaaactatttatgttggatcaaattttatttgtcttcggatgtttatgaatgggtcttcac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9459120 |
attacgtttgagtgttatttaaccaaaaattgacgttttcaaactatttatgttggatcaaattttatttgtctttggatgtttatgaatgggtcttcac |
9459021 |
T |
|
| Q |
207 |
aattaggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaac |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9459020 |
aattaggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaac |
9458970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 208 - 257
Target Start/End: Complemental strand, 27063519 - 27063470
Alignment:
| Q |
208 |
attaggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaac |
257 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27063519 |
attaggcatggcaacaaaacccgtgcccatggataaccgcccaaaccaac |
27063470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 256
Target Start/End: Original strand, 29014876 - 29014927
Alignment:
| Q |
205 |
acaattaggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaa |
256 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||||| | ||||||||||| |
|
|
| T |
29014876 |
acaattaggcatgacaacaaaactcgtgttaatggatatctgcccaaaccaa |
29014927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 257
Target Start/End: Complemental strand, 28309666 - 28309616
Alignment:
| Q |
207 |
aattaggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaac |
257 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
28309666 |
aattaggcatggcaacaaaacccgtgtccatggatatccgcccaaaccaac |
28309616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 260
Target Start/End: Complemental strand, 12915650 - 12915600
Alignment:
| Q |
210 |
taggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaacacc |
260 |
Q |
| |
|
||||||||||||||||| || ||||||||| || ||||||||||||||||| |
|
|
| T |
12915650 |
taggcatgacaacaaaatccatgcttatgggtacccgcccaaaccaacacc |
12915600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 210 - 257
Target Start/End: Original strand, 41914907 - 41914954
Alignment:
| Q |
210 |
taggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaac |
257 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
41914907 |
taggcatgacaacaaaacccatgcccatgggtaaccgcccaaaccaac |
41914954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 256
Target Start/End: Complemental strand, 37032491 - 37032444
Alignment:
| Q |
209 |
ttaggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaa |
256 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
37032491 |
ttaggcatggcaacaaaacccgtgctcatggatatccgccgaaaccaa |
37032444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 262
Target Start/End: Original strand, 39256370 - 39256422
Alignment:
| Q |
210 |
taggcatgacaacaaaacccgtgcttatggataaccgcccaaaccaacaccaa |
262 |
Q |
| |
|
|||||||| ||||||||||||||| |||| || |||||||||||||| |||| |
|
|
| T |
39256370 |
taggcatggcaacaaaacccgtgcccatgggtacccgcccaaaccaaccccaa |
39256422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University