View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_254 (Length: 263)
Name: NF11982A_low_254
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_254 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 2727679 - 2727939
Alignment:
| Q |
1 |
aacaattatgatcgactgacagtataaaaaatctttacgctatcggtgcatatacggaattagatccttatagttat--ggaagtttcacgtgctacaat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2727679 |
aacaattatgatcgactgacagtataaaaaatctttacactgtcggtgcatatacggaattaaatccttatagttatatggaagtttcacgtgctacaat |
2727778 |
T |
 |
| Q |
99 |
tcataccttcctaatccaaatggcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgcca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727779 |
tcataccttcctaatccaaatggcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgcca |
2727878 |
T |
 |
| Q |
199 |
aatttcccaaaagatcaagcaatgcaactccccaatttgtatccataggataaacaccaaa |
259 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727879 |
aatttcccaaaagatcaagtattgcaactccccaatttgtatccataggataaacaccaaa |
2727939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University