View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_265 (Length: 258)
Name: NF11982A_low_265
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_265 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 3651210 - 3651442
Alignment:
| Q |
20 |
aagtggatgtcaaacacgtcaatggggttggtaagaatatcatgaagctaattaattctagtaattgaaatgaattgaaagagttgcatgtgtatcttaa |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
3651210 |
aagtggatgtcaaaaacgtcaatggggttggtaagaatatcatgaagctaattaattatagtaatgaaaataaagtgaaagagttgcatgtgtatcttaa |
3651309 |
T |
 |
| Q |
120 |
aacagaaaacgtggcaatcgattttgatatggttaggggttctagaagaaacaacaatgccacaaagtagaaatgttaaacatttttcttaagactaatt |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3651310 |
aacagaaaa-gtggcaatcgattttgatatgtttaggggttctagaagaaacaacaatgccacaaagaagaaatgttaaacatttttcttaagactaatt |
3651408 |
T |
 |
| Q |
220 |
aaattccatatgagctctatttcacctactaatt |
253 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
3651409 |
aaatttcatatgagctctatttcacctactaatt |
3651442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University