View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_281 (Length: 253)
Name: NF11982A_low_281
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_281 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 15 - 252
Target Start/End: Original strand, 25135885 - 25136122
Alignment:
| Q |
15 |
aacataatagaacataaagctagcagcatgcttcttttaccctcaagttgcccatgaacaaatggcttcacaagaagtcgttgcatctatacttagaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25135885 |
aacataatagaacataaagctagcagcatgcttcttttaccctcaagttgcccatgaacaaatggcttcacaagaagtcgttgcatctatacttagaaaa |
25135984 |
T |
 |
| Q |
115 |
taagaaacgatgaaaaagcaaggtgtgaaaagttcatcaactctgtgcctttcctgttggttttggtgaattttgaggatactgatgatgaaacggagaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25135985 |
taagaaacgatgaaaaagcaaggtgtgagaagttcatcaactctgtgcctttcctgttggttttggtgaattttgaggatactgatgatgaaacggagaa |
25136084 |
T |
 |
| Q |
215 |
gcatgagtaccatgtgatatggaaagacttccttgttg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25136085 |
gcatgagtaccatgtgatatggaaagacttctttgttg |
25136122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University