View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_288 (Length: 251)
Name: NF11982A_low_288
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_288 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 3884226 - 3884464
Alignment:
| Q |
1 |
tttgtttcagtttagggacatgataaagatgttctttccagttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtct |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884226 |
tttgtttccttttagggacatgataaagatgttctttccatttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtct |
3884325 |
T |
|
| Q |
101 |
ggtcggacggagaatgcatcggcgagttgcattcaaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtgg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884326 |
ggtcgaacggagaatgcatcggcgagttgcattcaaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtgg |
3884425 |
T |
|
| Q |
201 |
ctatcaggtaagcccttcttccatcatgtgattgatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884426 |
ctatcaggtaagcccttcttccatcatgtgattgatatt |
3884464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 67 - 119
Target Start/End: Complemental strand, 35240846 - 35240794
Alignment:
| Q |
67 |
attgcctctgtcagtgaagattgtgcacgagtctggtcggacggagaatgcat |
119 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||||||| ||||||| |
|
|
| T |
35240846 |
attgcctctgtcagtgaagatgatgtacgtgtctggtcggacggacaatgcat |
35240794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 105
Target Start/End: Complemental strand, 35237828 - 35237790
Alignment:
| Q |
67 |
attgcctctgtcagtgaagattgtgcacgagtctggtcg |
105 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
35237828 |
attgcctctgtcactgaagattgtgcacgtgtctggtcg |
35237790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University