View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_315 (Length: 249)
Name: NF11982A_low_315
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_315 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 3 - 240
Target Start/End: Original strand, 9538979 - 9539217
Alignment:
| Q |
3 |
caactgaattcagcttgcgaggacatcacatgcatcagcttatagttgcagattcttctcacacaaatttttcagtgatatatcaatgttgttggaacat |
102 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
9538979 |
caactgagttaagctttcgaggacatcacatgcatcagtttatagttgcagattcttctcacacaaatttttcaatgatatatcaattttgttggaacat |
9539078 |
T |
 |
| Q |
103 |
tgttcaattatttaaattatgaactaagttcaaatatgattttttaaatatacta-nnnnnnnnaactcatgcataagattagaaactcacatttagatt |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9539079 |
tgttgaattatttaaattatgaactaagttcaaatatgattttttaaatatactatttttttttaactcatgcataagattagaaactcacatttagatt |
9539178 |
T |
 |
| Q |
202 |
tccttgtgttannnnnnncatttcaagtgtcatattctt |
240 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| |
|
|
| T |
9539179 |
tccttgtgttatttttttcatttcaagtgtcattttctt |
9539217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University