View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_322 (Length: 249)
Name: NF11982A_low_322
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_322 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 241
Target Start/End: Complemental strand, 18260325 - 18260089
Alignment:
| Q |
6 |
agattcccactaatattcctaatccaagtgaagttaaaaatgctattttttatttgaatcatgatggtgcaccagggcctcatgg-tttggtgcttgctt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18260325 |
agattcccactaatattcctaatccaagtgaagttaaaaatgctattttttatttgaatcatgatggtgcaccagggcctcatgggtttggtgcttgctt |
18260226 |
T |
 |
| Q |
105 |
tttccaaacctattgggatatagttcagaaagatgtgtatgaagctgtggtagaattcttcaagactggatcgctccttcccaactacaatgcaaactct |
204 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18260225 |
tttccaaacctattggaatatagttaagaaagatgtgtatgaagctgtggtagaattcttcaagactggatggctccttcccaactacaatgcaaactct |
18260126 |
T |
 |
| Q |
205 |
cttatcttgatccctaaaactccagatgctaacacca |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
18260125 |
cttatcttgatccctaaaactccatatgctgacacca |
18260089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University