View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_327 (Length: 248)
Name: NF11982A_low_327
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_327 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 41550980 - 41551207
Alignment:
| Q |
9 |
atccaacggtgttgatgcgtggaacgaagtgcagaagaattttgataagcttgcgaaagacggttttcttcatcgcgttgatttcggtcaatgcataggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550980 |
atccaacggtgttgatgcgtggaacgaagtgcagaagaattttgataagcttgcgaaagacggttttcttcatcgcgttgatttcggtcaatgcataggt |
41551079 |
T |
|
| Q |
109 |
caatttctttcttcaaatctcaatttatcataatcttgcaatgtttgttcaatgcatcttattcttannnnnnnnnnnngagtttctttaaatgcatttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41551080 |
caatttctttcttcaaatctcaatttatcataatcttgcaatgtttgttcaatgcatcttattcttattttttatttttgagtttctttaaatgcatttt |
41551179 |
T |
|
| Q |
209 |
agtttggtgaatttatggcctaaatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41551180 |
agtttggtgaatttatggcctaaatatt |
41551207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University