View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_341 (Length: 246)
Name: NF11982A_low_341
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_341 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 236
Target Start/End: Complemental strand, 48482603 - 48482373
Alignment:
| Q |
6 |
aacacagacgctaatatattgtgcagttcacaggtttgagctctggtctttcaactatgctaatcttattttccatgtgttcttttgaaaaactgttttt |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482603 |
aacacagacgctaatatattgcgcagttcacaggtttgagctctggtcttccaattatgctaatcttattttccatgtgttcttttgaaaaactgttttt |
48482504 |
T |
|
| Q |
106 |
gcattttaatttcattttagggtcccaaatccagattcagtagtggttgtgcatacccctctgggggtattctctccaagaacttcacttcaaaatcaca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482503 |
acattttaatttcattttagggtcccaaatccagattcagtagtggttgtgcatacccctctgggggtattctctccaagaacttcacttcaaaatcaca |
48482404 |
T |
|
| Q |
206 |
agggacgctttagaggatcaaagcttatttc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48482403 |
agggacgctttagaggatcaaagcttatttc |
48482373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University