View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_342 (Length: 246)
Name: NF11982A_low_342
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_342 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 232
Target Start/End: Original strand, 53735296 - 53735515
Alignment:
| Q |
13 |
ccagtctcaaaataactgtctaatttgtgtcatgcgtttgttcttgagaaaatatattaacgagtatttaaccttcttccacgtttataaaacttttatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
53735296 |
ccagtctcaaaataactgtctaatttgtgtcatgcgtttgttcttgagaaaatatattaacaagtatttaaccttctttcacatttataaaacttttatc |
53735395 |
T |
|
| Q |
113 |
tcctttcttcggcatagaacagcatgggtaccctaaacgaacctttgcaatatcccgctgctcgcagagatgactctgtctttgacgattaccatggcct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
53735396 |
tcctttcttcggcatagaacagcatgggtaccctagacgaacctttgcaatatcccgctgctcgcagagacgactctgtcgttgacgattaccatggcct |
53735495 |
T |
|
| Q |
213 |
caaaatcgccgacccttatc |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
53735496 |
caaaatcgccgacccttatc |
53735515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University