View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_369 (Length: 242)
Name: NF11982A_low_369
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_369 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 1330086 - 1329864
Alignment:
| Q |
20 |
caatgctagcattgctggccttccggctgaaccaagtgctacactgctagcacttccactgcaaccatatcccactccttgcatggctgcattcatttct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330086 |
caatgctagcattgctggccttccggctgaaccaagtgctacactgctagcacttccactgccaccatatcccactccttgcatggctgcattcatttct |
1329987 |
T |
|
| Q |
120 |
ccttgtttatacataccatccaacaataatgtatcaaagcctccacctaatgcaggctgctggtttcctaagtggctggttgattgtaccaacgctgttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329986 |
ccttgtttatacataccatccaacaataatgtatcaaagcctccacctaatgcaggctgctggtttcctaagtggctggttgattgtaccaacgctgttt |
1329887 |
T |
|
| Q |
220 |
cccaatctgcactctcgtcaaat |
242 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
1329886 |
cccaatctgcactctcatcaaat |
1329864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University