View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_372 (Length: 242)
Name: NF11982A_low_372
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_372 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 47583870 - 47584080
Alignment:
| Q |
12 |
aaaatatgatgtcatttctagcattctatattgaccacaaaatggtgtgccaaatcaacgctaagccttttggtagtttccctagacttacaaatggctc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583870 |
aaaatatgatgtcatttctagcattctatattgaccacaaaatggtgtgccaaatcaacgctaagccttttggtagtttccctagacttacaaatggctc |
47583969 |
T |
 |
| Q |
112 |
cactccaagagcacacagtagaatgattcactgcctgcacacgtgcatgttactcttctaataatcaatcgccatttctccgagaacctttcataggttt |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583970 |
cactccaagagcacacactagaatgattcactgcctgcacacgtgcatgttactcttctaataatcaatcgccatttctccgagaacctttcataggttt |
47584069 |
T |
 |
| Q |
212 |
caacaagattc |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
47584070 |
caacaagattc |
47584080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University