View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_403 (Length: 238)
Name: NF11982A_low_403
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_403 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 22 - 212
Target Start/End: Complemental strand, 38359492 - 38359303
Alignment:
| Q |
22 |
caggaatcaatccagaagttaatatcttccccatttcgaatatttcaagacacattttctagcacagtagagtatttatgcctagcaccaatcaaaacag |
121 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38359492 |
caggaatcaatccagaagttaatattttccccatttccaatatttcaagacacattttctagcacagtagagtatttatgcctagcaccactcaaaacag |
38359393 |
T |
 |
| Q |
122 |
gtgaagaaacatgataatcgactggnnnnnnngttccttaggatcctgcttctaatgaattgatcccattgtaaatctgattgcatgatat |
212 |
Q |
| |
|
||| ||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38359392 |
atgacgaaacatgataattgactgg-ttttttgttccttaggatcctgcttctaatgaactgatcccattgtaaatctgattgcatgatat |
38359303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University