View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_405 (Length: 237)
Name: NF11982A_low_405
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_405 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 22 - 186
Target Start/End: Original strand, 18729014 - 18729164
Alignment:
| Q |
22 |
ttgcttactttacacaatgtatgattgggatttcgtgccaattttaaacaatctcataccgttagattttgat--tatagttgagattcgtacctatgtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
18729014 |
ttgcttactttacacaatgtatgattgggatttcttgtcaattttaaacaatctcataccgtt-gatttagataatatagttgagattcgtacctatgt- |
18729111 |
T |
 |
| Q |
120 |
tcaatgtttttgcagataatctagtaatacacaatggaggattatgaaggctacttgtttaagttta |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18729112 |
--------------gataatctagtaatacacaatggaggattatgaaggctacttgtttaagttta |
18729164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 18729361 - 18729411
Alignment:
| Q |
178 |
ttaagtttaaactacttctttattcaaaacttcatatattagagttttgtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
18729361 |
ttaagtttaaactacttctttattcaaaacttgagatattagagttttgtt |
18729411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University