View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_406 (Length: 237)
Name: NF11982A_low_406
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_406 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 36163122 - 36162892
Alignment:
| Q |
8 |
atggagttacatagttataccacagcatagtttaaaatagggcaaaattaacaagcgtgtaaaaatacaaggcacatccaattgtcaagaactcaagaca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36163122 |
atggagttacatagttataccacagcatagtttaaaatagggcaaaattaacaagcgtgtaaaaatacaaggcacatccaattgtcaagaactcaagtca |
36163023 |
T |
 |
| Q |
108 |
gatagtttagtaaaaatacaaggccagtcttaatcaacttaaatgcagtaagacggat-nnnnnnnggacagcaagaggtttcaccttaaggagatacag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
36163022 |
gatagtttagtaaaaatacaaggccagtcttaatcaactttaatgcagtaagacggataaaaaaaaggacagcaagaggcttcaccttaaggagatacag |
36162923 |
T |
 |
| Q |
207 |
ctgggtcaaattcaagttgacacatgataga |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36162922 |
ctgggtcaaattcaagttgacacatgataga |
36162892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University