View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_409 (Length: 237)
Name: NF11982A_low_409
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_409 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 25014550 - 25014786
Alignment:
| Q |
1 |
gaatagcaatggaaggaaatggcataacaatgccaatatcagcattagtgaattcacatctgcttgtctctgcaatatttaacacttaacattagcatga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
25014550 |
gaatagcaatggaagcaaatggcataacaatgccaaaagcagcattagtgaattcacgtctgcttgtctctgcaaaatttaacacttaacattagcatta |
25014649 |
T |
|
| Q |
101 |
ttccacaatagagaaattaaagaaccnnnnnnntttcgctcattaggttaaaccgcggaatttgaaaaagacctgcaactacaatttaggccgcaatatc |
200 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25014650 |
ttccactatagagaaattaaagaactaaaaaaatttcactcattaggttaaaccgcggaatttgaaaaagacctgcaactgcaatttaggccgcaatatc |
25014749 |
T |
|
| Q |
201 |
aatannnnnnnnaatattgaatcctggttatctgaac |
237 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |
|
|
| T |
25014750 |
aatattttttttaatattgaatcctggttatccgaac |
25014786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University