View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_410 (Length: 237)
Name: NF11982A_low_410
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_410 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 55341954 - 55341744
Alignment:
| Q |
12 |
aattggttggaacgagattgcaatttcaatgtattcattaggaatggtacattatttgattctatttgtgacgctgtatcagcgtctaacaagtagtaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341954 |
aattggttggaacgagattgcaatttcaatgtattcattaggaatggtacattatttgattctatttgtgacgctgtatcagcgtctaacaagtagtaat |
55341855 |
T |
|
| Q |
112 |
cagtttcctgtagtgctaaggccagcttannnnnnnnnnnnngctgcgccaagcatggcaagtcttgcttggaaatccatctcaggtgcttttctcatct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341854 |
cagtttcctgtagtgctaaggccagcttattttttgttttttgctgcaccaagcatggcaagtcttgcttggaaatccatctcaggtgcttttctcatct |
55341755 |
T |
|
| Q |
212 |
catcgaagatg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
55341754 |
catcgaagatg |
55341744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University