View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_415 (Length: 235)
Name: NF11982A_low_415
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_415 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 23 - 182
Target Start/End: Complemental strand, 2623252 - 2623093
Alignment:
| Q |
23 |
aagggttaaggttcttctagaaatgccaagcacaaggactattgcagcgactgtgttcttaacatcagaatttatagaggaatctaagtatataatgaag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2623252 |
aagggttaaggttcttctagaaatgccaagcacaaggactacttcagcgactgtgttcttaacatcagaatttatagaggaatctaagtatataatgaag |
2623153 |
T |
 |
| Q |
123 |
tgcgcaaaaattagacacggtaaaatttcacatgaggtagcatgttgttggtcccctatt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2623152 |
tgcgcaaaaattagacacggtaaaatttcacatgaggtagcatgttgttggtcccctatt |
2623093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University