View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_426 (Length: 232)
Name: NF11982A_low_426
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_426 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 40925069 - 40924846
Alignment:
| Q |
8 |
cttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacagtccaactttcttaaaatggctgcgttcacctcccaaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925069 |
cttatactgtttgcttccattgttgtggttgctattgcagtgatattgatcttggcatacggtccaactttcttaaaatggctgcgttcacctcccaaac |
40924970 |
T |
 |
| Q |
108 |
caccacgggcagcggtggcacctttgcccctcactgagttgaacgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatgcagg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40924969 |
caccacgggcagcggtggcacctttgcccctcactgagttg-acgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatacagg |
40924871 |
T |
 |
| Q |
208 |
taacaacaagtacatttctttgagg |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40924870 |
taacaacaagtacatttctttgagg |
40924846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University