View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_low_43 (Length: 412)

Name: NF11982A_low_43
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_low_43
NF11982A_low_43
[»] chr5 (2 HSPs)
chr5 (100-212)||(42590891-42591004)
chr5 (249-358)||(42591181-42591288)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 6e-41; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 100 - 212
Target Start/End: Original strand, 42590891 - 42591004
Alignment:
100 taatggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgt 198  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| ||    
42590891 taatggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgt 42590990  T
199 aatacaagctggtg 212  Q
    ||||||||||||||    
42590991 aatacaagctggtg 42591004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 249 - 358
Target Start/End: Original strand, 42591181 - 42591288
Alignment:
249 atgtttcgtgtacatcgttttaacaccattctatagacattatgttgaaatgtcgtagcatgaattgaaacggtggcttactatttgcgttgcaatgaaa 348  Q
    ||||||| |||| |||||||||||||||||  ||| ||| |  ||||||||| | ||||||||||| ||||  | |||||||||||| |||| |||||||    
42591181 atgtttcttgtatatcgttttaacaccattacatacacagt--gttgaaatgacctagcatgaattcaaacaatagcttactatttgtgttgaaatgaaa 42591278  T
349 ctttttctat 358  Q
    ||||||||||    
42591279 ctttttctat 42591288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University