View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_449 (Length: 230)
Name: NF11982A_low_449
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_449 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 25014514 - 25014292
Alignment:
| Q |
1 |
gccttcactctacttgtcaagatctgctagcattgtgatgttggctgcatattttgcgtacttgatctttcaactatggacacacaggcaattattcgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25014514 |
gccttcactctacttgtcaagatctgctagcattgtgatgttggctgcatattttgcttacttgatctttcaactatggacacacaggcaattatttgaa |
25014415 |
T |
 |
| Q |
101 |
gctgaagatgtatgttttcttaattaaaccatatatgaaaatgatggatcattgatttgcaattttaatttttattataagtgtttataacatgattcat |
200 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25014414 |
gctgaagatgtatgctttcgtaattaaaccatatatgaaaatgatgaatcattgatttgcaattttaatttttattataagtgtttataacatgattcat |
25014315 |
T |
 |
| Q |
201 |
tgatgaacaggaaggtgaaggtg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25014314 |
tgatgaacaggaaggtgaaggtg |
25014292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 118
Target Start/End: Original strand, 5130259 - 5130351
Alignment:
| Q |
26 |
gctagcattgtgatgttggctgcatattttgcgtacttgatctttcaactatggacacacaggcaattattcgaagctgaagatgtatgtttt |
118 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||| | |||| ||||||||||| ||| | |||||||| ||||| |||||||||||||| |
|
|
| T |
5130259 |
gctagcattgtgatggtgattgcatattttgcataccttttcttccaactatggactcaccgacaattatttgaagcacaagatgtatgtttt |
5130351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University