View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_451 (Length: 230)
Name: NF11982A_low_451
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_451 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 132 - 230
Target Start/End: Original strand, 8683394 - 8683492
Alignment:
| Q |
132 |
cagaatcaaggcctcagagaaagtgacttcagatcacgttggttagctaggaatcaaaggattcttgattcattgctttctgaatcgtattccattatg |
230 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8683394 |
cagaatcaaggactcagagaaagtgacttcagatcacgttggttagctaggaatcaaaggattcttgattcattgctttctgaatcgtcttccattatg |
8683492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University