View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_474 (Length: 228)
Name: NF11982A_low_474
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_474 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 44952260 - 44952478
Alignment:
| Q |
1 |
agtcactctactcgatcgatgtccatatatgtgacacacaaaacaacataggagtgttgcatggtagcttctgacatcgtgaattaagtactgcctatgt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952260 |
agtcattctactcgatcgatgtccatatatgtgacacacaaaacaacataggagt--tgcatggtagcttctgacatcgtgaattaagtactgcctatgt |
44952357 |
T |
|
| Q |
101 |
cacttaggaattcccctctcattgttctcatgtgatccaacaaatagatccacatctagtgtgtttgtgttccccgcacttaggtttgtcaagatatgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44952358 |
cacttaggaattcccctctcattgttctcatgtgatccaacaaatagatccacatctagtgtgtttgtgttccccacacttaggtttgtcaagatatgat |
44952457 |
T |
|
| Q |
201 |
gaccacttacacacacatactt |
222 |
Q |
| |
|
||||| ||| |||||||||||| |
|
|
| T |
44952458 |
gacca-ttaaacacacatactt |
44952478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University