View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_5 (Length: 521)
Name: NF11982A_low_5
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_5 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 157; Significance: 3e-83; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 177 - 333
Target Start/End: Original strand, 149715 - 149871
Alignment:
| Q |
177 |
attgttgtaagtggaagtggaacaaacccttttatttcaactccattatatgtttcaagtggtggtgcaagttcttcaccttttgaaacccaatttgaaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149715 |
attgttgtaagtggaagtggaacaaacccttttatttcaactccattatatgtttcaagtggtggtgcaagttcttcaccttttgaaacccaatttgaaa |
149814 |
T |
|
| Q |
277 |
catccttaaccacaaaaagaccaagatatagtggacaatggaagcttctaccttcac |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149815 |
catccttaaccacaaaaagaccaagatatagtggacaatggaagcttctaccttcac |
149871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 450 - 521
Target Start/End: Original strand, 149988 - 150059
Alignment:
| Q |
450 |
ttagctgcttcttcatcagagacaacttcatcacaatctcatgatcattcaccaatgccttgtcaagaagga |
521 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149988 |
ttagctgcttcttcatcagagacaacttcatcacaatctcatgatcattcaccaatgccttgtcaagaagga |
150059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University