View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_500 (Length: 222)
Name: NF11982A_low_500
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_500 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 21 - 192
Target Start/End: Original strand, 31798689 - 31798862
Alignment:
| Q |
21 |
agtggctttgtcataagattttcatggaccatccattatttcgtgattgaacttgaatcttcaaattgcctacttgaattcctattnnnnnnnnnnnnct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
31798689 |
agtggctttgtcataagattttcatggaccatccattatttcgtgattgaacttgaatctacaaattgcctacttgaattcctattaaaaaaaaaaaact |
31798788 |
T |
 |
| Q |
121 |
acttgaattatat--aaacaaaatcttgcaagaattgttctactgagcaatcgaactagcaattaaaatcaatt |
192 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31798789 |
acttgaattatataaaaaaaaaatcttgcaagaattgttctactgagcaatcgaactagtaattaaaatcaatt |
31798862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University